Table 1 Materials and consumables
REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
Antibodies for Western blot | ||
Mouse monoclonal β-Actin (8H10D10) | Cell Signaling | #3700 |
Rabbit monoclonal AMPKα (D5 A2) | Cell Signaling | #5831 |
Rabbit monoclonal AR [EPR1535(2)] | Abcam | #ab133273 |
Rabbit monoclonal E-Cadherin (24E10) | Cell Signaling | #3195 |
Rabbit monoclonal phospho AMPKα (Thr172) (40H9) | Cell Signaling | #2535 |
Rabbit monoclonal PPARγ (C26H12) | Cell Signaling | #2435 |
Rabbit polyclonal mTOR | Cell Signaling | #2972 |
Rabbit polyclonal phospho mTOR (Ser2448) | Cell Signaling | #2971 |
Antibodies for immunofluorescence (IF) | ||
Anti-rabbit—Alexa fluor 488 | Invitrogen | #A11008 |
Rabbit monoclonal E-Cadherin (24E10) | Cell Signaling | #3195 |
Antibodies for immunohistochemistry (IHC) | ||
Rabbit monoclonal Ki67 (D3B5) | Cell Signaling | #12202 |
Rabbit polyclonal CC3 (Asp175) | Cell Signaling | #9661 |
Rabbit monoclonal phospho AMPKα (Thr 172) | Cell Signaling | #2535 |
Rabbit monoclonal phospho mTOR (Ser2448) | Cell Signaling | #2976 |
Chemicals, peptides, and recombinant proteins | ||
2-deoxy-glucose (2-DG) | Sigma Aldrich | #D8375 |
Annexin V | Thermo Fisher Scientific | #R37174 |
Antimycin A | Sigma Aldrich | #A8674 |
Bezafibrate | Sigma Aldrich | #B7273 |
Bodipy 493/503 | Invitrogen | #D392 |
Bovine Serum Albumin (BSA) | Sigma Aldrich | #A9418 |
Clarity Western ECL Substrate | Biorad | #170–561 |
DAPI | Sigma Aldrich | #D9542 |
Fat-free BSA | Carl Roth | #00.52 |
FCCP | Sigma Aldrich | #C2920 |
Fetal calf serum (FCS) | Gibco | #10500064 |
Fluorescence mounting media | DAKO | #S3023 |
Formaldehyde | Sigma Aldrich | #252549 |
Gibco DMEM, no glucose | Thermo Fisher Scientific | #11966025 |
Glucose | Agilent | #103577–100 |
Glutamine | Agilent | #103579–100 |
Laemmli buffer | Biorad | #1610747 |
Nitrocellulose membrane | Amersham Protran | #10600001 |
Oligomycin | Sigma Aldrich | #495455 |
PBS | Carl Roth | #1105 |
Penicillin/streptomycin | Gibco | #15140122 |
Pioglitazone | Sigma Aldrich | #CDS021593 |
Poly-L-lysine | Sigma Aldrich | #P2636 |
PonceauS | Merck | #15,927 |
Protease inhibitor cOmplete Mini | Roche | #11836153001 |
Universal block | DCS Innovative Diagnostik Systeme | #UL123R100 |
Pyruvate | Agilent | #103578–100 |
Resazurin | Sigma Aldrich | #B70717 |
RIPA buffer | Boston BioProducts | #B- 115 |
Rotenone | Sigma Aldrich | #557368 |
RPMI | Gibco | #52400–025 |
Seahorse XF RPMI medium | Agilent | #103576–100 |
Tesaglitazar | Sigma Aldrich | #SML1369 |
Tween20 | Sigma Aldrich | #P1379 |
Commercial assays | ||
Coomassie Blue Bradford assay | Thermo Fisher Scientific | #23236 |
CyQUANT NF cell proliferation assay kit | Thermo Fisher Scientific | #C35006 |
cDNA synthesis kit | NEB | #M0368 |
Luna qRT-PCR master mix | NEB | #M3003 |
RNA isolation kit | NEB | #TS2010S |
Punch kit | Merck | #MAMP09608 |
Experimental models: Cell lines | ||
Human: 22RV1 cells | ATCC | CRL- 2505 |
Human: PC3 cells | ATCC | CRL- 1435 |
Experimental models: mice | ||
NSG mice | Charles River | |
Oligonucleotides | ||
AR: 5’− 3’ forward AGAGTGCCCTATCCCAGTCC | This paper | N/A |
AR: 5’− 3’ reverse TGGCAGTCTCCAAACGCAT | This paper | N/A |
AR: 5’− 3’ forward GTCTTCCCCTCCATCGTG | This paper | N/A |
AR: 5’− 3’ reverse AGGGTGAGGATGCCTCTCTT | This paper | N/A |
PPARA: 5’− 3’ forward GCTGTCACCACAGTAGCTTG | This paper | N/A |
PPARA: 5’− 3’ reverse AGCTTCCAGAACTATCCTCGC | This paper | N/A |
PPARD: 5’− 3’ forward CAGAGCTATGACTGGGCCTG | This paper | N/A |
PPARD: 5’− 3’ reverse CTCCGGGAGAGGTCTGTGTA | This paper | N/A |
PPARG: 5’− 3’ forward GTGCAATCAAAGTGGAGCCTG | This paper | N/A |
PPARG: 5’− 3’ reverse TCCGGAAGAAACCCTTGCATC | This paper | N/A |
Software and algorithms | ||
Enrichr | Chen, EY. Et al., 2013 [29] Kuleshov, MV. et al., 2016 [30] Xie, Z. et al., 2021 [31] | |
FlowJo _V10 | FlowJo BD Biosciences | |
Gen5™ Data Analysis Software | Biotek | N/A |
GraphPad Prism 8 | GraphPad by Dotmatics | |
ImageLab | Biorad | https://www.bio-rad.com/de-at/product/image-lab-software?ID=KRE6P5E8Z |
IncuCyte | Sartorius | https://www.sartorius.com/en/products/live-cell-imaging-analysis/live-cell-analysis-software |
Interacti Venn | Heberle, H. et al., 2015 [32] | |
KM Plotter | Gyorffy, B. et al. 2023 [33] | |
Prostate Cancer Atlas | Bolis, M. et al. 2021 [34] | |
ProteoWizard | Chambers, M. et al. 2012 [35] | |
QuPath- 0.5.1 | Bankhead et al. 2017 [36] | |
Seahorse Wave Desktop | Agilent | |
SR Plot | SRPLOT | |
Zen2 blue | Zeiss | https://www.micro-shop.zeiss.com/de/de/softwarefinder/software-categories/zen-blue |
R packages “Survival”, “Survminer”, R-script “ggsurvplot | The Comprehensive R Archive Network | |
fgsea R package (version 1.22.0) | Korotkevich, G. et al., 2016 [37] | https://bioconductor.org/packages/release/bioc/html/fgsea.html |
R Studio 4.2.0 | Posit | |
Perseus 1.6.15.0 | MaxQuant | |
NMR Suite 10.0 profiler | ChenomX Inc, Edmonton, Canada | |
InstantClue 0.12.1 | Nolte, H. et al., 2018 [38] | |
msigdbr R package (version 7.5.1) | Liberrzon, A. et al., 2015 [39] Subramanian, A. et al., 2005 [40] | |
DIA-NN 1.8.1 | Demichev, V. et al. 2020 [41] | |
Bruker Topspin 1.3 | Bruker | https://www.bruker.com/en/products-and-solutions/mr/nmr-software/topspin.html |
SIMCA-P + 17.0 | Umetrics, Umeå, Sweden | |
Other | ||
96-well filter plates | Merck Millipore | #MADVN6550 |
Axio Imager M2 | ZEISS | |
BD FACS Canto 2 | BD Biosciences | |
Bruker spectrometer 600 MHz | Bruker | |
ChemiDoc MP Imaging system | BioRad | |
Easy nLC1000-QExactive Plus | Thermo Fisher Scientific | |
Gamma Counter Wizard | PerkinElmer | |
Imagelock 96well plates | Sartorius | #BA- 04856 |
Incucyte S3 live cell imaging | Sartorius | |
Seahorse XF Pro M cell culture Microplate | Agilent | #103774–100 |
Seahorse XF- 96 analyzer | Agilent | |
Superfrost microscopy slides | Epredia | #J1800 AMNZ |
Synergy H1 microplate reader | Biotek | N/A |